Otogl^em1(IMPC)J

This allele from project Otogl-7415J-M363 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCTGAGATGGTCCCTTGG, GAGATGGTCCCTTGGTGGTG, CCATGATCGAGACCGTCTCG, and CCCGAGACGGTCTCGATCAT, which resulted in a 270 bp deletion spanning exon 4 beginning at Chromosome 10 negative strand position 107,903,262 bp, CCCCGAGACGGTCTCGATCA, and ending after TGAGATGGTCCCTTGGTGGT at 107,902,993 bp (GRCm38/mm10). This mutation deletes exon 4 and 203 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 47 and early truncation 119 amino acids later. (J:188991)