This allele from project Dalrd3-7439J-M5809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGTTCCGTGGATCCCGCT, GTAAGTGGGCCGTAGTTCCG, GAGTCATGATAATCTAAGCC, and GTGCGTGTTCGAAGCTATAA, which resulted in a 413 bp deletion spanning ENSMUSE00000221392 (exon 2) beginning at Chromosome 9 negative strand position 108,570,528 bp, CAGGCTTAGATTATCATGAC, and ending after GTGTAAGTGGGCCGTAGTTC at 108,570,116 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 55 and early truncation 45 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count