This allele produced from project TCPR0430 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TCAAGAATCGACGTTCTGGC, CAGATGCCCCCCAAGTCAAG, GCTTTGATCTTCGTGCTAAC, and GGATCTATGAACCTCCGGCC. This resulted in a 1,034-bp deletion from Chr6:92242806 to 92243839 (GRCm38) in exons ENSMUSE00000194388 and ENSMUSE00000414256, p.(F14*). (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count