Tmem160^em1(IMPC)Tcp

This allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AGTGTCCGAGCTGGATCGCG and ACTTCTGTCATCCGGCATTG. This resulted in a 1,033 bp deletion from Chr7:16453129 to 16454161 and 16 bp deletion from Chr7:16454205 to 16454221, from within exons ENSMUSE00000384664 and ENSMUSE00000198013, removing the splice donor site from the distal exon. This mutation is predicted to cause a frameshift with amino acid changes after residue 57 and early truncation 5 amino acids later (p.R57Wfs*7) (GRCm38). (J:165963)