This allele from project TCPR0321, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GGCCAGTTGGAGCTATGCGA and GAGAAGCACGCGTCCTCCTC. This resulted in a 486 bp deletion from Chr8:119771064 to 119771549 encompassing ENSMUSE00000318051 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count