This allele, from project TCPR0311, was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNAs with spacer sequences CAGCGAGACTGAATAAATTA, GTCACGTGGTATGATACCTC, GGACTGTCGGGAGTAATCAA, and GTTTAGATTATCAGGCCCTG. This resulted in a 1154 bp-deletion from Chr1:75131276 to 75132429 in OTTMUSE00000662432 & OTTMUSE00000662425 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count