This allele, from project TCPR0362, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences TCAGCGGATACTCAAACCCG and GGAGAACCTAAGGCTATCAG. This resulted in a 388 bp deletion from Chr6:147032784 to 147033171 in ENSMUSE00000277388. This mutation is predicted to cause a frameshift with amino acid changes after residue 41 and early truncation 2 amino acids later (p.F41Vfs*4). (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count