This allele from project TCPR0369 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences gagtttactctgacatacct and CCCGTTGGCAGTGGTCTAGC. This resulted in a 2486 bp deletion from Chr5:142506252 to 142508737 encompassing ENSMUSE00001259653 & ENSMUSE00001280414 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count