This allele from project TCPR0379 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences ATGCTACGTGTTATGTTGGG and AGTCCTGTCCTGCATGCAGG. This resulted in a 915 bp deletion from Chr1:30944289 to 30945203 encompassing OTTMUSE00000245667 & OTTMUSE00000245014 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count