This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA, the guide sequence CCGGCATTTATCTGAGATCTTCT, and a donor oligo, which resulted in a 1 bp insertion at Chr14:24482833_insT in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count