This allele from project TCPR0359 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TCGGGCTTATTGCCTTGAAG and TTCCCGGCTCTTTTGACGGT. This resulted in a 614 bp deletion and 174 bp insertion from Chr13:96392926 to 96393539, exon ENSMUSE00000119907. (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count