This allele produced from project TCPR0368 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GGAACAGGACATGCACCTAG and AGGGAGTGACCGAAGACTGC. This resulted in a 61 bp deletion from Chr13:21433448 to 21433508 in ENSMUSE00000571630. This mutation is predicted to cause a frameshift with amino acid changes after residue 57 and early truncation 51 amino acids later (p.L57Rfs*53) (GRCm38). (J:165963)