Nhs^em1(IMPC)Tcp

This allele produced from project TCPR0257 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ACATCTTCCTCCCAGCGACC and CTTGCTCTCGATGTCCAAGT. This resulted in a 77 bp deletion from ChrX:161875305 to 161875381 in ENSMUSE00000470130. This mutation is predicted to cause a frameshift with amino acid changes after residue 190 and early truncation 19 amino acids later (p.L190Qfs*21). (GRCm38). (J:165963)