This allele from project TCPR0309 was generated at the The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in a 2-bp insertion +TC in Chromosome 1 positive strand 191822642 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.465_466insTC; p.(L157Sfs*4) (J:165963)