This allele produced from project TCPR0322 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATAGGTGACTTAGCCTGACG and AGCCTCACCAACACGGGCAA. This resulted in a 672-bp deletion from Chr5:114452046 to 114452717 (GRCm38), OTTMUSE00000170059. (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count