This allele from project TCPR0368 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs (targeting AGGTAGCAGGGACCATCGCA and TATCTCCAGATCAACATCGG) targeting a critical region. This resulted in a 142 bp deletion from Chr14:52299764 to 52299905 (GRCm38) (GRCm39:chr14:52537221-52537362) in exon 3 (ENSMUSE00001224053). This mutation causes a frameshift and premature stop codon (p.I173Mfs*6). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count