This allele from project TCPR307 was generated at the Toronto Centre for Phenogenomics by injecting Cas9 endonuclease and two single guide RNAs with spacer sequences CGTACATATATACTTTAGGC targeting the 5' side and CCCTATAAATGATACCACAC targeting the 3' side of exon 7 (exon ENSMUSE00000769617) resulting in deletion of Chr17 from 68456904 to 68457678. (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count