This allele from project TCPR0370 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TCCAAGATTGACGTGTAGAT and GAAGGCACTACATCTAATGC. This resulted in a 734 bp deletion from Chr10:26342355 to 26343088 in ENSMUSE00000309524 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count