This allele produced from project TCPR0417 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences GTGAGCTCGGTCTTGGTTTG, CTTCAGGACGGTGTACTGCC, CAGCTCAGTGTCCTAATCAC, and ATGTCCGTTTGGCAGAATAG. This resulted in a 5-bp deletion from Chr10:18785183 to 18785187, a 1,713-bp deletion from Chr10:18783181 to 18784893 deleting majority of ENSMUSE00000403934 including splice donor (single exon ORF) & 6-bp deletion from Chr10:18783159 to 18783164 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count