This allele produced from project TCPR0362 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences CGGAACAGCCACCAGATGGT and CTGCAATTCCGAGATATACC. This resulted in an 894 bp deletion from Chr5:61809118 to 61810011, and ins 152bp in exon ENSMUSE00000409179. This mutation is predicted to cause a frameshift with amino acid changes after residue 80 and early truncation 12 amino acids later (p.I80Cfs*14). (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count