This allele, from project TCPR0407, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GAGTGTGGAGTGCGATAGTG, TGTCACACTAATGTCACTCG, GAGGTGCAAGCCTACCCTAG and TCCGAACTTCCTGCGGGAGC. This resulted in a 1,167 bp deletion from Chr18:50281278 to 50282444, encompassing ENSMUSE00000373759. (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count