This allele produced from project TCPR0398 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences GCTTAGAAACCATCTTACAT, CTAATCACTGGGGGGGTCAA, GTGAATCAGATGACTGCGCG, and ACCACCCTGCTGAAGTGTTT. This resulted in a 475-bp deletion from Chr9:114709042 to 114709516 insTTC (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count