This allele produced from project TCPR0367 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GTTTACCTAGGCAGCTTCCG and ATGCAGTCCGACCATGGTAT. This resulted in a 71-bp deletion from Chr8:36102633 to 36102703 insT (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count