This allele produced from project TCPR0431 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences ACTACATTGCTGTGAATTGG, GACTGGTCACTTCATGCTAG, ATATACGCGCACTTGAGACA and CTCGTCTGTTAAACATTCAA. This resulted in a 683-bp deletion on Chr1 from 178321411 to 178322093 and an indel at Chr1: 178322209_178322210_insTAAAC (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count