This allele was produced from project TCPR0372 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATGCAAGCATACTATTACAC and AATTTGGGCTCTTTTAGGCC. This resulted in a 1,533-bp deletion from Chr4:3942187 to 3943719 insCT (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count