This allele produced from project TCPR0366 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TGGAAAACCTGGTCCAGTGC and GATCTCGGATATGGTCTTGG in ENSMUSE00000144777. This resulted in a 83-bp deletion from Chr19:7509375 to 7509457 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count