This allele, from project TCPR0387, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences GGGCACAGAGTGACTTGCAC, ACTGTATCCCCCAGTTTGGT and ACTTCGGGTCAGGCCAAGTA. This resulted in a 1,410 bp deletion from 89601843 to 89603253 on Chr 9 encompassing exon ENMUSE00000334339. This mutation is predicted to cause a frameshift with amino acid changes after residue 31 and early truncation 2 amino acids later (p.C31Tfs*4). (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count