This allele produced from project TCPR0384 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences AGAGACGCCTGGCAGAGCGG and GGTCTTCTCGGATGACCTGC. This resulted in a 5-bp deletion in Chr12:88401979 to 88401983 and a 123-bp deletion in Chr12:88402032 to 88402154 (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count