This allele, from project TCPR0409, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GGGGAGGTCCTCCGTCATCC, TCAGCACTTCAGGCCAGGTC, GTGAGTTGGGATATTCTTGC, and GGCCTGCTGCTCTCCCCGTG. This resulted in an indel at Chr13:8569440 del T insCCTCCTCTGA; a 1140-bp deletion on Chr13 from 8569541 to 8570680; and an indel at Chr13:85670687 insT (GRCm38). (J:165963)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count