This allele produced from project TCPR0315 at The Centre for Phenogenomics by injecting Cas9 D10A mRNA and four guide RNAs having spacer sequences AGCCGCTCGGCCCCGCGCTA, AGCGGAGGGCGTCTCGCCCT, TGTACTCCGTGTCGAAGCGT and AGGCTGCAACAATCAGTATC. This resulted in an indel comprised of a 42-bp deletion on Chr 4 from 155992472 to 155992513 with a 2-bp insertion of CC (GRCm38). (J:165963)