Scamp2^em1(IMPC)J

This allele from project Scamp2-7483J-M6175 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAGCATTAAGGAATACCAT, CCAGCACAGGCACTTCACCC, ACTCTGAACCACCTTCATGG, and CCTGCTCTACCTGGCACAAG, which resulted in a 349 bp deletion spanning ENSMUSE00000259135 (exon 4) beginning at Chromosome 9 positive strand position 57,579,268 bp, GGCACTCCCATGGTATTCCTT and ending after TACTCTGAACCACCTTCATG at 57,579,616 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause a change in amino acid sequence after residue 75 and early truncation 14 amino acids later. (J:188991)