Nectin4^em1(IMPC)J

This allele from project Pvrl4-7418J-M4968 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGACTCTGAGCTTGGGCT, GGACTCTGAGCTTGGGCTGG, TCTATGCCCCGACTTAGCTA and TCTGAACCCTAGCTAAGTCG, which resulted in a 401 bp deletion spanning exon 4 beginning at Chromosome 1 positive strand position 171,383,458 bp GGTCTTATGAGCTCAGGGCA and ending after ACATATTCTGAACCCTAGCT at 171,383,858 bp (GRCm38/mm10). This mutation deletes exon 4 and 280 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after amino acid residue 242 and early truncation 11 amino acid later. (J:188991)