Ndufs8^em1(IMPC)J

This allele from project Ndufs8-7413J-M338 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, CTACCTTGATACACTCCCCC, TTTAGGGCCTAGTAGTTAGA, TCAGGCGTGGACGGCCGGAG and GAGAGTCAGGCGTGGACGGC, which resulted in a 282 bp deletion spanning exon 5 beginning at Chromosome 19 negative strand position 3,911,117 bp, CGGCCGGAGAGGAGAGCATCC, and ending after CCCTACCTTGATACACTCC at 3,910,836 bp (GRCm38/mm10). This mutation deletes exon 5 and 109 bp of intronic sequence including the splice acceptor and donor. It is predicted to result in a change in amino acid sequence after residue 69 and early truncation 3 amino acids later. (J:188991)