This allele from project Hpse2-7398J-F2290 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCCTCCAACACTCAAAAT, GTCCCGATTTTGAGTGTTGG, GTGCTCTCTAGCCTTCTCCC, and TAGATAATAAATCTCCCACC, which resulted in a 285 bp deletion spanning exon 2 beginning at Chromosome 19 negative strand position 43,385,002 bp, CCCACCAGGTCTCCTGCAGG and ending after AGAAATTTGGTCCCGATTTT at 43,384,718 bp (GRCm38/mm10). This mutation deletes exon 2 and 127 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after 96 amino acids and early truncation 4 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count