This allele from project Arhgap29-7394J-F2209 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTGCTTCAAAGCACAAAG, AGATCAGTTGCAGTAAGTGG, TGTACGGTACATGAATCTGC, and ACATGAATCTGCGGGATAAA, which resulted in a 274 bp deletion spanning exon 4 beginning at Chromosome 3 positive strand position 121,988,385 bp, TTTGTGCTTTGAAGCAATGGTG, and ending after TACGGTACATGAATCTGCGG at 121,988,658 bp (GRCm38/mm10). There is a 36 bp insertion in the intron that will not affect the exon deletion. This mutation deletes exon 4 and 177 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 114 and early truncation 8 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count