This allele from project Ust-7382J-F715 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATTTGAGTAAGCTGTTAAG, TGATTTGAGTAAGCTGTTAA, ACAGCTGAGCTTGTTGCAAA, and GGCAGATAACCATTAGCGTG, which resulted in a 221 bp deletion spanning exon 4 beginning at Chromosome 10 negative strand position 8,307,547 bp, TTAGCGTGTGGCTTAGAGAG, and ending after GCTCCATCTAATGAGCAACCCCT at 8,307,327 bp (GRCm38/mm10). This mutation deletes exon 4 and 141 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 150 and early truncation 17 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count