Loxl1^em2J

This loxP flanked allele from project Loxl1-6513J-101P2M(2R)was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, GAATGGCATGCCACAAGTAA and TCAGATACTTTGCCAGACTC, along with a plasmid containing 2618 bp of Loxl1 sequence comprised of 1 kb 5-prime and 3-prime homology arms with two 60 bp-cassettes flanking exon 2 that contain a loxP site, HindIII cut site, and an additional unique 20 bp sequence as a sequencing primer. This allele shows a complete integration of the Loxl1 2618 bp sequence by homologous recombination beginning in Chromosome 9 negative strand position 58,298,994 bp CATGACTCAAGCACCCCATCTTTAC, and ending after GGACTATCTTAAGTGCCCAGC at 58,296,497 bp (GRCm38), resulting in a loxP flanked exon 2. It is predicted that mating this strain with cre will generate a deletion of exon 2 causing a change of amino acid sequence after amino acid 400 and early truncation 22 amino acids later. (J:188991)