The allele was generated by injecting Cas9 RNA and guide sequences homologous to Engase exon 3 (GTGGAGGCCGGCGACACACC and GGAGGCCGGCGACACACCAG). The CRISPR/cas9 endonuclease mediated genome editing introduced a 4 nt (gtgt) deletion within exon 3. The mutant generated contains a discrete 4 nt GTGT deletion in exon 3 within the Engase open reading frame causing a frameshift beginning at Val 104 and leading to translation termination 18 amino acids later. The mutant mouse is predicted to express a 121 amino acid 13.5 kDa polypeptide from the Engase gene. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count