Rxfp3^em1(IMPC)J

This allele from project Rxfp3-6943J-F9508 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGTGGCTTCTGCAACCCCCG, with a non-contributing plasmid, which resulted in a 20 bp deletion (TGCAGGTGGCTTCTGCAACC) in exon 1 beginning at Chromosome 15 positive strand position 11,037,264 bp (GRCm38/mm10). The 20 bp deletion alters the coding sequence such that the first 11 amino acids are changed followed by a stop codon, and is therefore predicted to be a null allele. (J:188991)