Gpr15^em1(IMPC)J

This allele from project Gpr15-6923J-M9817 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATACAACTGTGTAAAAGATA, with a non-contributing plasmid, which resulted in an 8 bp deletion (CTCCCTAT) in exon 1 beginning at Chromosome 16 negative strand position 58,718,619bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 36 and early truncation 39 amino acids later. (J:188991)