Zfp579^em1(IMPC)J

This allele from project Zfp579-7041J-M1234 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, CGGAAAGCTTTGGGGCACAG and CCAAGAGCACGCAGGTAGCG, which resulted in a 1 bp T insertion in exon 1 beginning at Chromosome 7 positive strand position 49,94,713bp (GRCm38/mm10). This mutation results in a change of amino acid sequence after amino acid residue 78 and early truncation 49 amino acid residues later. In addition, 141 bases after the T insertion there is an 8 bp deletion GTAGCGAG, which does not appear to affect the result of the insertion. (J:188991)