This allele from project Zfp329-7039J-F1199 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, AGTTGAGTGGCTTCCATGGA and CAAGAGATTTTATAAAGGTA, which resulted in a 13bp deletion beginning in exon 2 ATGGAAGCCACTC at Chromosome 7 negative strand position 12,811,259 bp ATGGAAGCCACTC (GRCm38) and ending after position 12,811,246 bp in exon 2. This mutation is predicted to cause amino acid sequence changes after 112 amino acid residues and early truncation 2 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count