Zfp641^em1(IMPC)J

This allele from project Zfp641-7067J-M4958 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ACGGGAACTAACAAGCCAGT, GCAGCCGCACTTCTTGCAGC, and AAGTGCATCCTGGGAAAGAT, which resulted in a 214 bp deletion beginning in intron 3 at Chromosome 15 negative strand position 98,293,024 bp, GAAAGATGGGTAGTTCATC, and ending after CTTTGGCATCATCCCACTGG at 98,292,811 bp(GRCm38/mm10) in intron 4. The 214 bp mutation deletes all of exon 3 and is predicted to result in a change of amino acid sequence after amino acid 61 and early truncation 64 amino acids later. (J:188991)