Prkx^em1(IMPC)J

This allele from project Prkx-6999J-M3432 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATAACGTTAGGGAGGTGAGG, CTCTTGGGAGAATAACGTTA, TTATCTTTAAGGCCCCAGAT, and ATGGACATCATGCCAATCTG, which resulted in a 283 bp deletion beginning in intron 2 at Chromosome X negative strand position 77,786,367 bp,TTGGCATGATGTCCATTCCTC, and ending after CCACCTCCTCACCTCCCTAA at 77,786,085 bp(GRCm38/mm10) in intron 3. The 283 bp mutation deletes all of exon 2 and is predicted to result in a change of amino acid sequence after amino acid 54 and early truncation 12 amino acids later. (J:188991)