Adgra1^em1(IMPC)J

This allele from project Adgra1-6965J-M4387 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GTGACTGATACGGATGGCCA, ACAAGTCACATAAAGAGCCC, GTCCCAGGATGGAAGGATTG, and GGCTCAAGTCCCAGGATGGA, which resulted in a 254 bp deletion beginning in intron 4 at Chromosome 7 positive strand position 139,845,536 bp, GAGCCCTGGCCATCCGTATCAGT, and ending after CCCAATCCTTCCATCCTGG at 139,845,789 bp(GRCm38/mm10) in intron 5. The 254 bp mutation deletes all of exon 4 and is predicted to result in a change of amino acid sequence after amino acid 4 and early truncation 61 amino acids later. (J:188991)