This allele from project Arr3-7032J-M2356 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, ATCCTCATTGCCCTTCCATT, CCATTCTTCAGCATCTCGGT, ATTGGCCTCATAGCTCTGCA, and AGGCCAATTGAAAGGTAGAA, which resulted in a 313 bp deletion beginning in intron 4 at Chromosome X positive strand position 100,606,939 bp at GAATGGAAGGGCAATGAGGATG and ending after GAAAGGAAAGAATCCTTTCAG at 100,607,251 bp (GRCm38/mm10) in intron 5. This mutation results in the deletion of exon4 and is predicted to cause a change in amino acid sequence after residue 13 and early truncation 10 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count