Arap3^em1(IMPC)J

This allele from project Arap3-7000J-M3454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGGGGTCTGATCCCGAGGAG, GCATCAGTGCTACAGGACAC, and AAAGTCTGAGGCTTGGACAG, which resulted in a 775bp deletion beginning in intron 2 at Chromosome 18 negative strand position 37,997,244 bp, TTTGGGCATTCTTCTTTGAAAGAGAT, and ending after ATTTCCTTTCAGGACTCCAGATA at 37,996,470 bp (GRCm38/mm10) in exon 3. This mutation results in the deletion of exon 2, which includes the start of translation, intervening intron and 11 bp in exon 3 and is predicted to be a null allele. (J:188991)