This allele from project Pbsn-6978J-F3145 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: TTAAGGTCGTGCATTCATTC,ACATTGGAATGTAGATATCA,TCGTATTGTATATTACTCCA, and TTTATGTGGAATCAGGACCC, which resulted in a 212 bp deletion in intron 3 beginning at Chromosome X negative strand position 77,845,123 bp, CCCTGGAGTAATATACAATACG, and ending after TGATATCTACATTCCAATGTAA at 77,844,912 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to cause early truncation after 72 amino acids. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count