This allele from project Krt80-6977J-M3128 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: ACTTCCTCTTTCTCCACCTT,CACCCCACCAGAGTACAGCC, TGACAGGGAGCCCCACCTCG, and AGATGAGCTGCCCTGTGACA, which resulted in a 378 bp deletion beginning in intron 2 at Chromosome 15 negative strand position 101,364,511 bp, GTGACAGGGAGCCCCACCTCG, and ending after CTGGTGGGGTGCACCCAAG at 101,364,134 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause an early stop after amino acid residue 101. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count