This allele from project Mrpl3-6966J-F0101 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences: CACTTCTTATAATAACACGG, ACAAACCACACCATTCCCTG, CAAGCCATACTGTAATTAAG, TTATCTGGAAACAAATAAGC, which resulted in a 355 bp deletion beginning in intron 2 at Chromosome 9 positive strand position 105,054,289 bp, CCCCGTGTTATTATAAGAAGTGT, and ending after GATGTGACCCCTTAATTAC at position 105,054,643 bp (GRCm38/mm10) in intron 3. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 45 amino acids later. There is an additional 37 bp deletion in intron 3, downstream of the 355 bp deletion, that is not expected to impact the exon deletion results. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count